Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659215

gRNA Name: ccdc40 gRNA1
Synonyms:
Genomic Target: ccdc40

Sequence: 5' TAGGAAGAGGAGACAGCTGAAG 3'



Genomic Target tropicalis laevis.S
Identities 20/22 19/22
genome
gRNA
5' CTTCAGCTGTCTCCTCTTCCCC 3'
   ||||||||||||||||||||  
3' GAAGTCGACAGAGGAGAAGGAT 5'
5' CTTCAGCTGTCTCCTCTTTCCT 3'
   |||||||||||||||||| |  
3' GAAGTCGACAGAGGAGAAGGAT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr9_10S:21840621..21840642 19/22 Antisense target ccdc40.S
Chr3S:124830379..124830400 20/22 Antisense off-target dand5.S
Chr2L:47372323..47372344 19/22 Antisense off-target myl10.L
Chr8S:17785346..17785367 19/22 Antisense off-target setd3.S
Chr8S:27487275..27487296 19/22 Antisense off-target LOC108699878
Chr7L:19190020..19190041 19/22 Sense off-target LOC108696120
Chr5L:157483888..157483909 18/22 Sense off-target eva1a.L
Chr6L:113774714..113774735 18/22 Sense off-target myom1.L
Chr5L:157483888..157483909 18/22 Sense off-target LOC121393851
Chr2L:180955904..180955925 18/22 Sense off-target LOC108707772
Chr7S:56359554..56359575 18/22 Sense off-target LOC108697224
Chr1L:191370875..191370896 19/22 Sense unknown
Chr2L:160739893..160739914 19/22 Sense unknown
Chr8L:13294189..13294210 19/22 Sense unknown
Chr6S:103920514..103920535 19/22 Sense unknown
Chr3S:91457159..91457180 18/22 Sense unknown
Chr4L:130707936..130707957 18/22 Antisense unknown
Chr4L:81625361..81625382 18/22 Antisense unknown
Chr4S:128867955..128867976 18/22 Antisense unknown
Chr5L:26276092..26276113 18/22 Sense unknown
Chr5S:104959686..104959707 18/22 Sense unknown
Chr5S:133444366..133444387 18/22 Sense unknown
Chr1S:14887495..14887516 18/22 Sense unknown
Chr2S:4350448..4350469 18/22 Sense unknown
Chr7S:503176..503197 18/22 Antisense unknown
Chr7S:60454191..60454212 18/22 Sense unknown
Chr6L:107723189..107723210 18/22 Antisense unknown
Chr9_10S:2001901..2001922 18/22 Antisense unknown
Chr9_10S:30275906..30275927 18/22 Sense unknown
tropicalis 10.0 Chr10:32820640..32820661 20/22 Antisense target ccdc40
Chr10:32884388..32884409 20/22 Antisense target ccdc40
Chr10:32754876..32754897 20/22 Antisense off-target LOC101731483
Chr10:32754876..32754897 20/22 Antisense off-target LOC105945381
Chr10:32792401..32792422 20/22 Antisense off-target LOC108648942
Chr10:32792401..32792422 20/22 Antisense off-target LOC116407966
Chr1:105660466..105660487 19/22 Antisense off-target bsg
Chr3:107884700..107884721 19/22 Antisense off-target furin
Chr3:120309716..120309737 19/22 Sense off-target unc5d
Chr3:84392835..84392856 19/22 Sense off-target il15ra
Chr8:77534408..77534429 19/22 Antisense off-target sipa1l3
Chr8:133665699..133665720 19/22 Antisense off-target LOC100489858
Chr3:65396428..65396449 18/22 Antisense off-target nrcam
Chr6:106979144..106979165 18/22 Sense off-target myom1
Chr6:154174073..154174094 18/22 Antisense off-target nuggc
Chr6:154174681..154174702 18/22 Antisense off-target nuggc
Chr6:154175061..154175082 18/22 Antisense off-target nuggc
Chr6:154175289..154175310 18/22 Antisense off-target nuggc
Chr7:68547644..68547665 18/22 Sense off-target opcml
Chr6:154176278..154176299 18/22 Antisense off-target nuggc
Chr6:154176658..154176679 18/22 Antisense off-target nuggc
Chr6:154177343..154177364 18/22 Antisense off-target nuggc
Chr6:154177723..154177744 18/22 Antisense off-target nuggc
Chr2:113498086..113498107 18/22 Antisense off-target atp10a
Chr6:103593927..103593948 18/22 Antisense off-target spire1
Chr5:65939445..65939466 18/22 Antisense off-target LOC101734009
Chr2:46582447..46582468 19/22 Antisense unknown
Chr6:99380758..99380779 19/22 Sense unknown
Chr10:22189805..22189826 18/22 Antisense unknown
Chr2:156829593..156829614 18/22 Antisense unknown
Chr3:117357470..117357491 18/22 Sense unknown
Chr5:80461405..80461426 18/22 Antisense unknown
Publications
First: CRISPR/Cas9: An inexpensive, efficient loss of function tool to screen human disease genes in Xenopus., Dev Biol 2015              
Most recent:
View All Papers