Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659213

gRNA Name: cfap298 gRNA1
Synonyms: kur
Genomic Target: cfap298

PAM Sequence: GGG
Sequence: 5' GAGGCCACAGACCAGCTGAG 3'



Genomic Target tropicalis laevis.L
Identities 19/20 20/20
genome
gRNA
5' CTCAGTTGGTCTGTGGCCTC 3'
   ||||| ||||||||||||||
3' GAGTCGACCAGACACCGGAG 5'
5' CTCAGCTGGTCTGTGGCCTC 3'
   ||||||||||||||||||||
3' GAGTCGACCAGACACCGGAG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:14633711..14633730 20/20 Sense target cfap298.L
Chr3L:155123228..155123247 18/20 Sense off-target LOC108710453
Chr3S:16038778..16038797 18/20 Sense off-target LOC108712641
Chr1S:190272309..190272328 17/20 Sense off-target st8sia3.S
Chr2L:153448979..153448998 18/20 Antisense unknown
Chr4S:122834383..122834402 18/20 Antisense unknown
Chr3L:62579849..62579868 17/20 Antisense unknown
tropicalis 10.0 Chr2:15190524..15190543 19/20 Sense target cfap298
Chr2:4606865..4606884 19/20 Antisense off-target lsamp
Chr2:139800939..139800958 17/20 Antisense off-target shmt2
Chr10:36932818..36932837 16/20 Antisense unknown
Publications
First:
Most recent:
View All Papers