Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659205

gRNA Name: ctnnb1 gRNA1
Synonyms:
Genomic Target: ctnnb1

PAM Sequence: TGG
Sequence: 5' GGAAAGCAGCAGTCAGTCAC 3'



Genomic Target tropicalis laevis.S
Identities 20/20 19/20
genome
gRNA
5' GTGACTGACTGCTGCTTTCC 3'
   ||||||||||||||||||||
3' CACTGACTGACGACGAAAGG 5'
5' GTGACTGACTGCTGCTTTTC 3'
   |||||||||||||||||| |
3' CACTGACTGACGACGAAAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6S:46319213..46319232 19/20 Sense target ctnnb1.S
Chr5S:121267509..121267528 18/20 Antisense off-target alkal2.S
Chr6L:151833573..151833592 18/20 Sense off-target LOC121394765
Chr7S:81449486..81449505 17/20 Antisense off-target atad3a.S
Chr7L:53776226..53776245 17/20 Sense off-target LOC108703996
Chr4S:21829793..21829812 16/20 Sense off-target tub.S
Chr5L:99200569..99200588 16/20 Antisense off-target phf3.L
Chr7L:98774214..98774233 16/20 Antisense off-target foxj3.L
Chr7L:32595911..32595930 16/20 Sense off-target LOC108705596
Chr7L:32699767..32699786 16/20 Sense off-target LOC108696187
Chr4S:84384710..84384729 18/20 Sense unknown
Chr6L:84581876..84581895 17/20 Antisense unknown
Chr1L:117214555..117214574 17/20 Antisense unknown
Chr1S:97874927..97874946 17/20 Antisense unknown
Chr7L:32566038..32566057 17/20 Sense unknown
Chr7L:32671263..32671282 17/20 Sense unknown
Chr7L:32677034..32677053 17/20 Sense unknown
Chr6L:16227942..16227961 16/20 Antisense unknown
Chr6L:9905689..9905708 16/20 Antisense unknown
Chr2S:157656785..157656804 16/20 Sense unknown
Chr3L:4262564..4262583 16/20 Sense unknown
tropicalis 10.0 Chr6:53369627..53369646 20/20 Sense target ctnnb1
Chr1:21117885..21117904 19/20 Sense off-target LOC100492954
Chr9:59060710..59060729 17/20 Sense off-target ube2f
Chr6:49099547..49099566 17/20 Sense off-target tgfbr2
Chr4:60676354..60676373 17/20 Sense off-target LOC105947250
Chr5:94831570..94831589 16/20 Antisense off-target phf3
Chr5:20297536..20297555 16/20 Sense off-target ttc7a
Chr3:124062637..124062656 18/20 Sense unknown
Chr1:53710358..53710377 17/20 Sense unknown
Chr2:84852283..84852302 17/20 Antisense unknown
Publications
First: Efficient genome editing of genes involved in neural crest development using the CRISPR/Cas9 system in Xenopus embryos., Cell Biosci 2016            
Most recent:
View All Papers