Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659200

gRNA Name: rbl1 gRNA3
Synonyms: rbl1{cr2}
Genomic Target: rbl1

PAM Sequence: GGG
Sequence: 5' TGGGCTTGCGCGCTGATGTG 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' CACATCAGCGCGCAAGCCCA 3'
   ||||||||||||||||||||
3' GTGTAGTCGCGCGTTCGGGT 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:7215028..7215047 16/20 Antisense unknown
tropicalis 10.0 Chr10:42372629..42372648 20/20 Antisense target rbl1
Publications
First: CRISPR/Cas9 mediated knockout of rb1 and rbl1 leads to rapid and penetrant retinoblastoma development in Xenopus tropicalis., Sci Rep 2016                            
Most recent:
View All Papers