Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659198

gRNA Name: rb1 gRNA3
Synonyms: rb1{cr2}
Genomic Target: rb1

PAM Sequence: CGG
Sequence: 5' GCTGTATGATTGTGCTGTAC 3'



Genomic Target tropicalis laevis.S
Identities 20/20 20/20
genome
gRNA
5' GTACAGCACAATCATACAGC 3'
   ||||||||||||||||||||
3' CATGTCGTGTTAGTATGTCG 5'
5' GTACAGCACAATCATACAGC 3'
   ||||||||||||||||||||
3' CATGTCGTGTTAGTATGTCG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:117486861..117486880 20/20 Antisense target rb1.S
chr3S:59893933..59893952 19/20 Sense off-target tln2.S
chr9_10S:54044178..54044197 18/20 Antisense off-target kcnj3.S
chr1L:93694943..93694962 18/20 Sense off-target LOC108712235
chr1S:120529537..120529556 18/20 Sense off-target LOC108706439
chr2L:135634116..135634135 19/20 Antisense unknown
chr8S:18127560..18127579 18/20 Antisense unknown
chr4S:72871493..72871512 17/20 Sense unknown
chr5S:55077238..55077257 17/20 Sense unknown
chr7L:59794050..59794069 17/20 Sense unknown
tropicalis 10.0 Chr2:135006672..135006691 20/20 Antisense rb1
Chr3:38492205..38492224 18/20 Sense nr3c1
Chr7:55940101..55940120 17/20 Antisense clstn1
Chr3:47962519..47962538 16/20 Antisense gfra3
Chr2:156830855..156830874 16/20 Antisense
Chr8:97249704..97249723 16/20 Sense
Publications
First: CRISPR/Cas9 mediated knockout of rb1 and rbl1 leads to rapid and penetrant retinoblastoma development in Xenopus tropicalis., Sci Rep 2016                            
Most recent:
View All Papers