Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659197

gRNA Name: rb1 gRNA2
Synonyms: rb1{cr1}
Genomic Target: rb1

PAM Sequence: GGG
Sequence: 5' AGACAAACAAGGGAACGGGA 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' TCCCGTTCCCTTGTTTGTCT 3'
   ||||||||||||||||||||
3' AGGGCAAGGGAACAAACAGA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr5S:61819310..61819329 18/20 Sense off-target crybg1.S
chr6S:98325119..98325138 17/20 Antisense off-target stau2.S
Scaffold30:2782578..2782597 16/20 Antisense off-target sdk2.L
chr1L:165162150..165162169 16/20 Sense off-target wscd2.L
chr5L:103714050..103714069 16/20 Antisense off-target atp11b.L
Scaffold74003:195..214 16/20 Sense unknown
chr6L:127078271..127078290 16/20 Antisense unknown
chr6S:54590746..54590765 16/20 Sense unknown
tropicalis 10.0 Chr2:135006606..135006625 20/20 Sense target rb1
Chr1:205112268..205112287 18/20 Antisense unknown
Chr4:56351283..56351302 18/20 Antisense unknown
Chr6:101716027..101716046 18/20 Antisense unknown
Chr6:30254470..30254489 18/20 Sense unknown
Publications
First: CRISPR/Cas9 mediated knockout of rb1 and rbl1 leads to rapid and penetrant retinoblastoma development in Xenopus tropicalis., Sci Rep 2016                            
Most recent:
View All Papers