Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659189

gRNA Name: cfap206 gRNA1
Synonyms: cfap206 sgRNA1
Genomic Target: cfap206

Sequence: 5' GACTGTGGGAAAGGTGGAGAAGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' CCTTCTCCACCTTTCCCACAGTC 3'
   |||||||||||||||||||||||
3' GGAAGAGGTGGAAAGGGTGTCAG 5'
5' CCTTCTCCACCTTTCCCACAGTC 3'
   |||||||||||||||||||||||
3' GGAAGAGGTGGAAAGGGTGTCAG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:78520184..78520206 23/23 Antisense target cfap206.L
Chr4L:6627527..6627549 19/23 Antisense off-target sycp3.L
Chr4L:71843070..71843092 19/23 Sense off-target dnai3.L
Chr6S:73642696..73642718 19/23 Sense off-target ripk1.S
Chr8S:26020853..26020875 19/23 Sense off-target lin52.S
Chr8S:26020853..26020875 19/23 Sense off-target aldh6a1.S
Chr4L:116633676..116633698 20/23 Sense unknown
Chr5S:65710155..65710177 20/23 Antisense unknown
Chr9_10S:79132714..79132736 20/23 Antisense unknown
Chr1L:91195314..91195336 19/23 Antisense unknown
Chr1S:51924563..51924585 19/23 Antisense unknown
Chr6L:88398749..88398771 19/23 Antisense unknown
tropicalis 10.0 Chr5:75253627..75253649 23/23 Antisense target cfap206
Chr1:76998150..76998172 19/23 Antisense off-target grid2
Chr2:167486022..167486044 19/23 Sense off-target chordc1
Chr3:146046802..146046824 19/23 Antisense off-target LOC105946957
Chr8:43757947..43757969 20/23 Sense unknown
Chr1:87660254..87660276 19/23 Sense unknown
Chr6:15154982..15155004 19/23 Antisense unknown
Chr6:15155921..15155943 19/23 Antisense unknown
Chr6:15156860..15156882 19/23 Antisense unknown
Publications
First: The FOXJ1 target Cfap206 is required for sperm motility, mucociliary clearance of the airways and brain development., Development 2020                                        
Most recent:
View All Papers