Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659188

gRNA Name: cfap206 gRNA2
Synonyms: cfap206 sgRNA2
Genomic Target: cfap206

Sequence: 5' TGCCCAGGAATGTGCGGTGAAGG 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' CCTTCACCGCACATTCCTGGGCA 3'
   |||||||||||||||||||||||
3' GGAAGTGGCGTGTAAGGACCCGT 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr5L:78524390..78524412 23/23 Antisense target cfap206.L
tropicalis 10.0 Chr9:85421485..85421507 19/23 Antisense off-target tns1
Chr4:21873706..21873728 19/23 Antisense off-target tnnt3
Chr9:85421485..85421507 19/23 Antisense off-target LOC116407773
Chr1:84915826..84915848 19/23 Sense unknown
Publications
First: The FOXJ1 target Cfap206 is required for sperm motility, mucociliary clearance of the airways and brain development., Development 2020                                        
Most recent:
View All Papers