Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659187

gRNA Name: dlg5 gRNA1
Synonyms:
Genomic Target: dlg5

Sequence: 5' GGTAAAGGATGGAGAGGAGG 3'



Genomic Target tropicalis laevis.L
Identities 19/20 19/20
genome
gRNA
5' CCTCCTCTCCATCCTTTACT 3'
   ||||||||||||||||||| 
3' GGAGGAGAGGTAGGAAATGG 5'
5' CCTCCTCTCCATCCTTTACT 3'
   ||||||||||||||||||| 
3' GGAGGAGAGGTAGGAAATGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr7L:55387799..55387818 19/20 Antisense target dlg5.L
Chr7S:40478763..40478782 18/20 Sense off-target sh2d4b.S
Chr9_10S:99563153..99563172 18/20 Antisense off-target ankfn1l.S
Chr7L:15905723..15905742 18/20 Antisense off-target LOC108696109
Chr8L:107154445..107154464 18/20 Sense off-target LOC121397166
Chr9_10L:42623778..42623797 17/20 Sense off-target top1.1.L
Chr3L:141931372..141931391 17/20 Antisense off-target camsap3.L
Chr3L:37822531..37822550 17/20 Sense off-target adamts2.L
Chr1S:116160103..116160122 16/20 Sense off-target kdm4c.S
Chr5L:112949167..112949186 16/20 Sense off-target meltf.L
Chr5S:6336287..6336306 18/20 Sense unknown
Chr2S:15670531..15670550 17/20 Antisense unknown
Chr4S:101124920..101124939 17/20 Antisense unknown
Chr6L:15540032..15540051 16/20 Sense unknown
tropicalis 10.0 Chr7:53774372..53774391 19/20 Antisense target dlg5
Chr3:140807432..140807451 18/20 Sense off-target cacna1a
Chr5:106093169..106093188 16/20 Sense off-target meltf
Chr1:33039215..33039234 18/20 Sense unknown
Chr5:352216..352235 17/20 Sense unknown
Chr5:31921986..31922005 17/20 Sense unknown
Chr6:33767327..33767346 16/20 Sense unknown
Publications
First: DLG5 variants are associated with multiple congenital anomalies including ciliopathy phenotypes., J Med Genet 2021                          
Most recent:
View All Papers