Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659183

gRNA Name: rbl1 gRNA1
Synonyms:
Genomic Target: rbl1

Sequence: 5' TGGGCTTGCGCGCTGATGTGGGG 3'



Genomic Target tropicalis laevis.L
Identities 23/23 21/23
genome
gRNA
5' CCCCACATCAGCGCGCAAGCCCA 3'
   |||||||||||||||||||||||
3' GGGGTGTAGTCGCGCGTTCGGGT 5'
5' TCCCACATCAGCACGCAAGCCCA 3'
    ||||||||||| ||||||||||
3' GGGGTGTAGTCGCGCGTTCGGGT 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr9_10L:34235507..34235529 21/23 Sense target rbl1.L
tropicalis 10.0 Chr10:42372626..42372648 23/23 Antisense target rbl1
Publications
First: RBL1 (p107) functions as tumor suppressor in glioblastoma and small-cell pancreatic neuroendocrine carcinoma in Xenopus tropicalis., Oncogene 2020            
Most recent:
View All Papers