Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659182

gRNA Name: rb1 gRNA1
Synonyms:
Genomic Target: rb1

Sequence: 5' GCTGTATGATTGTGCTGTACCGG 3'



Genomic Target tropicalis laevis.S
Identities 23/23 22/23
genome
gRNA
5' CCGGTACAGCACAATCATACAGC 3'
   |||||||||||||||||||||||
3' GGCCATGTCGTGTTAGTATGTCG 5'
5' CCTGTACAGCACAATCATACAGC 3'
   || ||||||||||||||||||||
3' GGCCATGTCGTGTTAGTATGTCG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr2S:117486858..117486880 22/23 Antisense target rb1.S
chr3S:59893933..59893955 19/23 Sense off-target tln2.S
chr9_10S:54044175..54044197 19/23 Antisense off-target kcnj3.S
chr6L:20508794..20508816 19/23 Sense off-target map3k8.L
chr2L:135634113..135634135 21/23 Antisense unknown
chr8S:18127557..18127579 20/23 Antisense unknown
chr1S:142200346..142200368 19/23 Sense unknown
tropicalis 10.0 Chr2:135006669..135006691 23/23 Antisense rb1
Publications
First: RBL1 (p107) functions as tumor suppressor in glioblastoma and small-cell pancreatic neuroendocrine carcinoma in Xenopus tropicalis., Oncogene 2020            
Most recent:
View All Papers