Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659181

gRNA Name: dsp gRNA2
Synonyms:
Genomic Target: dsp

Sequence: 5' GGTCGCATCTGACAGTTTGATGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 21/23 23/23 22/23
genome
gRNA
5' CCATCAAACTGACAGATGCGATC 3'
   ||||||||||| ||||||||| |
3' GGTAGTTTGACAGTCTACGCTGG 5'
5' CCATCAAACTGTCAGATGCGACC 3'
   |||||||||||||||||||||||
3' GGTAGTTTGACAGTCTACGCTGG 5'
5' CCATCAAACTGTCAGATGCGATC 3'
   ||||||||||||||||||||| |
3' GGTAGTTTGACAGTCTACGCTGG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:94123616..94123638 23/23 Antisense target dsp.L
Chr6S:75306100..75306122 22/23 Antisense target dsp.S
Chr4L:142659547..142659569 19/23 Antisense off-target mitf.L
Chr1L:193542273..193542295 19/23 Antisense off-target LOC108717391
Chr1S:197843247..197843269 19/23 Antisense off-target LOC108705540
Chr4S:55118580..55118602 19/23 Sense off-target LOC121393289
Chr3L:131364108..131364130 19/23 Sense unknown
tropicalis 10.0 Chr6:89201085..89201107 21/23 Antisense target dsp
Chr1:186603190..186603212 19/23 Antisense unknown
Chr8:50133593..50133615 19/23 Sense unknown
Publications
First: Desmoplakin is required for epidermal integrity and morphogenesis in the Xenopus laevis embryo., Dev Biol 2019                              
Most recent:
View All Papers