Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659180

gRNA Name: dsp gRNA1
Synonyms:
Genomic Target: dsp

Sequence: 5' GTGCTGGTTCATGATAAGCTGG 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 21/22 22/22 22/22
genome
gRNA
5' CCAGCTTATCCTGAACCAGCAC 3'
   |||||||||| |||||||||||
3' GGTCGAATAGTACTTGGTCGTG 5'
5' CCAGCTTATCATGAACCAGCAC 3'
   ||||||||||||||||||||||
3' GGTCGAATAGTACTTGGTCGTG 5'
5' CCAGCTTATCATGAACCAGCAC 3'
   ||||||||||||||||||||||
3' GGTCGAATAGTACTTGGTCGTG 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:94114454..94114475 22/22 Antisense target dsp.L
Chr6S:75298027..75298048 22/22 Antisense target dsp.S
Chr9_10L:82868302..82868323 19/22 Sense off-target cops8.L
Chr4S:17586514..17586535 18/22 Antisense off-target lrrc4c.S
tropicalis 10.0 Chr6:89193097..89193118 21/22 Antisense target dsp
Chr5:25344895..25344916 19/22 Sense off-target LOC105947449
Chr6:59722219..59722240 18/22 Sense off-target vwc2
Chr2:127102899..127102920 20/22 Antisense unknown
Chr4:33175381..33175402 19/22 Antisense unknown
Publications
First: Desmoplakin is required for epidermal integrity and morphogenesis in the Xenopus laevis embryo., Dev Biol 2019                              
Most recent:
View All Papers