Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659179

gRNA Name: copb1 gRNA2
Synonyms: copb1 sgRNA4, sgRNA4
Genomic Target: copb1

Sequence: 5' GGAGCACTCGCTCATGGGAA 3'



Genomic Target tropicalis laevis.L
Identities 19/20 19/20
genome
gRNA
5' TTCCCATGAGCGAGTGCTAC 3'
   |||||||||||||||||| |
3' AAGGGTACTCGCTCACGAGG 5'
5' TTCCCATGAGCGAGTGCTGC 3'
   |||||||||||||||||| |
3' AAGGGTACTCGCTCACGAGG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr4L:1923092..1923111 19/20 Antisense target copb1.L
tropicalis 10.0 Chr4:3444553..3444572 19/20 Antisense target copb1
Chr6:114842240..114842259 18/20 Sense off-target atp6v1h
Publications
First: Biallelic variants in COPB1 cause a novel, severe intellectual disability syndrome with cataracts and variable microcephaly., Genome Med 2021              
Most recent:
View All Papers