Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659176

gRNA Name: chd1 gRNA1
Synonyms:
Genomic Target: chd1

PAM Sequence: CGG
Sequence: 5' TCTGAACTGGAACTTGCCGA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 20/20
genome
gRNA
5' TCGGCAAGTTCCAGTTCAGA 3'
   ||||||||||||||||||||
3' AGCCGTTCAAGGTCAAGTCT 5'
5' TCGGCAAGTTCCAGTTCAGA 3'
   ||||||||||||||||||||
3' AGCCGTTCAAGGTCAAGTCT 5'
5' TCGGCAAGTTCCAGTTCAGA 3'
   ||||||||||||||||||||
3' AGCCGTTCAAGGTCAAGTCT 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr1L:191440070..191440089 20/20 Antisense target chd1.L
Chr1S:164369595..164369614 20/20 Antisense target chd1.S
Chr9_10S:54603953..54603972 17/20 Sense off-target wnt6.S
Chr4L:94542465..94542484 17/20 Sense off-target brinp2.L
Chr6L:18168648..18168667 17/20 Sense unknown
Chr6L:18260367..18260386 17/20 Sense unknown
Chr1L:52463328..52463347 16/20 Antisense unknown
tropicalis 10.0 Chr1:176139088..176139107 20/20 Antisense target chd1
Chr10:48226174..48226193 17/20 Antisense off-target tbcd
Chr6:134464977..134464996 16/20 Sense unknown
Publications
First: Using an aquatic model, Xenopus laevis, to uncover the role of chromodomain 1 in craniofacial disorders., Genesis 2021                          
Most recent:
View All Papers