Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659172

gRNA Name: rnf20 gRNA1
Synonyms:
Genomic Target: rnf20

Sequence: 5' GGTGGCCAGAGTGGCCAAAA 3'



Genomic Target tropicalis
Identities 19/20
genome
gRNA
5' TTTTGGCCACTCTGGCCAGC 3'
   |||||||||||||||||| |
3' AAAACCGGTGAGACCGGTGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 9.2 chr4L:124088573..124088592 19/20 Antisense off-target itpr1.L
chr5S:25033646..25033665 18/20 Sense off-target gpr75.S
chr9_10L:111700490..111700509 16/20 Sense off-target pemt.L
chr1S:84422939..84422958 19/20 Sense unknown
chr9_10S:99667107..99667126 17/20 Sense unknown
tropicalis 10.0 Chr7:57239369..57239388 19/20 Antisense target rnf20
Chr10:40963548..40963567 18/20 Sense off-target plcg1
Chr2:8904484..8904503 17/20 Antisense off-target tff3.5
Chr1:76656449..76656468 18/20 Sense unknown
Chr8:112019624..112019643 18/20 Antisense unknown
Chr6:54955686..54955705 17/20 Sense unknown
Chr6:54956238..54956257 16/20 Sense unknown
Publications
First: Histone H2B monoubiquitination regulates heart development via epigenetic control of cilia motility., Proc Natl Acad Sci U S A 2019                                    
Most recent:
View All Papers