Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659171

gRNA Name: ctnnd1 gRNA2
Synonyms: ctnnd1sgRNA1
Genomic Target: ctnnd1

Sequence: 5' GGGGTGGTATCCCACGCAAG 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' CTTGCGTGGGATACCACCCC 3'
   ||||||||||||||||||||
3' GAACGCACCCTATGGTGGGG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr7:55622711..55622730 20/20 Sense target ctnnd1
Publications
First: Novel truncating mutations in CTNND1 cause a dominant craniofacial and cardiac syndrome., Hum Mol Genet 2020                    
Most recent:
View All Papers