Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659140

gRNA Name: itsn1 gRNA2
Synonyms: itsn1_g2
Genomic Target: itsn1

PAM Sequence: GGG
Sequence: 5' ATCGTTGCCGGAGGAGCCGA 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' TCGGCTCCTCCGGCAACGAT 3'
   ||||||||||||||||||||
3' AGCCGAGGAGGCCGTTGCTA 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
tropicalis 10.0 Chr2:14218438..14218457 20/20 Antisense itsn1
Chr3:123146512..123146531 17/20 Sense
Chr3:123146550..123146569 17/20 Sense
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent: Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022          
View All Papers