Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659138

gRNA Name: dnm2 gRNA2
Synonyms: dnm2_g2
Genomic Target: dnm2

PAM Sequence: AGG
Sequence: 5' CAGCTATCTGAGGCAAGTCG 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' CGACTTGCCTCAGATAGCTG 3'
   ||||||||||||||||||||
3' GCTGAACGGAGTCTATCGAC 5'
5' CGACTTGCCTCAGATAGCCG 3'
   |||||||||||||||||| |
3' GCTGAACGGAGTCTATCGAC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:148294385..148294404 19/20 Antisense target dnm2.L
Chr3S:123852027..123852046 19/20 Antisense off-target LOC108703474
Chr1S:52842674..52842693 17/20 Antisense off-target larp1b.S
Chr2L:98391424..98391443 17/20 Antisense off-target LOC108708302
Chr8L:4936351..4936370 17/20 Antisense unknown
Chr2L:65061570..65061589 16/20 Antisense unknown
Chr4L:65567889..65567908 16/20 Antisense unknown
tropicalis 10.0 Chr3:138759512..138759531 20/20 Antisense target dnm2
Chr8:7336213..7336232 17/20 Antisense off-target olfm1
Chr5:84456970..84456989 18/20 Antisense unknown
Chr3:35391522..35391541 17/20 Antisense unknown
Chr5:147984398..147984417 16/20 Sense unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers