Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659137

gRNA Name: dnm2 gRNA1
Synonyms: dnm2_g1
Genomic Target: dnm2

PAM Sequence: GGG
Sequence: 5' CGGAGACCGAGTGCAGCCAT 3'



Genomic Target tropicalis laevis.L
Identities 20/20 20/20
genome
gRNA
5' ATGGCTGCACTCGGTCTCCG 3'
   ||||||||||||||||||||
3' TACCGACGTGAGCCAGAGGC 5'
5' ATGGCTGCACTCGGTCTCCG 3'
   ||||||||||||||||||||
3' TACCGACGTGAGCCAGAGGC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:148294281..148294300 20/20 Sense target dnm2.L
Chr3S:123851923..123851942 20/20 Sense off-target LOC108703474
tropicalis 10.0 Chr3:138759408..138759427 20/20 Sense target dnm2
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers