Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659135

gRNA Name: celsr2 gRNA1
Synonyms: celsr2_g1
Genomic Target: celsr2

PAM Sequence: TGG
Sequence: 5' GTGGCTGTAATTCTGGCCAG 3'



Genomic Target tropicalis laevis.L
Identities 20/20 20/20
genome
gRNA
5' CTGGCCAGAATTACAGCCAC 3'
   ||||||||||||||||||||
3' GACCGGTCTTAATGTCGGTG 5'
5' CTGGCCAGAATTACAGCCAC 3'
   ||||||||||||||||||||
3' GACCGGTCTTAATGTCGGTG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr2L:73229125..73229144 20/20 Antisense target celsr2.L
Chr3L:83868854..83868873 17/20 Antisense off-target slc26a5.L
Chr6S:39434449..39434468 16/20 Antisense off-target thrb.S
Chr2S:53103365..53103384 16/20 Antisense off-target LOC108709434
Chr5S:115781780..115781799 18/20 Sense unknown
tropicalis 10.0 Chr2:63373489..63373508 20/20 Sense target celsr2
Chr7:102363479..102363498 17/20 Antisense unknown
Chr8:86684606..86684625 16/20 Sense unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent: Identification and validation of candidate risk genes in endocytic vesicular trafficking associated with esophageal atresia and tracheoesophageal fistulas., HGG Adv 2022          
View All Papers