Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659116

gRNA Name: ezh2 gRNA2
Synonyms: ezh2_g2
Genomic Target: ezh2

PAM Sequence: TGG
Sequence: 5' AGCAGTTTGGATTCACAGAA 3'



Genomic Target tropicalis laevis.L laevis.S
Identities 20/20 20/20 19/20
genome
gRNA
5' TTCTGTGAATCCAAACTGCT 3'
   ||||||||||||||||||||
3' AAGACACTTAGGTTTGACGA 5'
5' TTCTGTGAATCCAAACTGCT 3'
   ||||||||||||||||||||
3' AAGACACTTAGGTTTGACGA 5'
5' TTCTCTGAATCCAAACTGCT 3'
   |||| |||||||||||||||
3' AAGACACTTAGGTTTGACGA 5'
   
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:58354345..58354364 20/20 Antisense target ezh2.L
Chr6S:48286572..48286591 19/20 Antisense target ezh2.S
Chr1S:195409355..195409374 18/20 Antisense off-target setbp1.S
Chr5S:119179802..119179821 18/20 Antisense off-target dzip1l.S
Chr4S:67925198..67925217 17/20 Antisense off-target dab1.S
Chr3L:71503778..71503797 17/20 Sense off-target zcrb1.L
Chr9_10L:33333692..33333711 17/20 Antisense off-target LOC108701017
Chr5S:41282811..41282830 16/20 Antisense off-target strn.S
Chr1L:18891804..18891823 16/20 Antisense off-target reep1.L
Chr1L:14776662..14776681 16/20 Sense off-target adra1d.L
Chr3L:102327389..102327408 16/20 Sense off-target LOC108710294
Chr7S:89442893..89442912 19/20 Antisense unknown
Chr7L:119394130..119394149 18/20 Antisense unknown
Chr2S:83810391..83810410 17/20 Antisense unknown
Chr2S:134142998..134143017 16/20 Antisense unknown
tropicalis 10.0 Chr6:55170690..55170709 20/20 Antisense target ezh2
Chr3:107953805..107953824 18/20 Sense off-target fes
Chr3:80054768..80054787 18/20 Antisense off-target sema3e
Chr2:20352280..20352299 18/20 Antisense off-target tmprss15
Chr9:19979482..19979501 18/20 Antisense off-target arhgap17
Chr3:80054768..80054787 18/20 Antisense off-target LOC108646168
Chr5:105731625..105731644 16/20 Antisense off-target mcf2l.2
Chr4:61559410..61559429 18/20 Antisense unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers