Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659115

gRNA Name: ezh2 gRNA1
Synonyms: ezh2_g1
Genomic Target: ezh2

Sequence: 5' GACCGGTGTGTTGGCGTAAG 3'



Genomic Target tropicalis laevis.L
Identities 20/20 19/20
genome
gRNA
5' CTTACGCCAACACACCGGTC 3'
   ||||||||||||||||||||
3' GAATGCGGTTGTGTGGCCAG 5'
5' CTTCCGCCAACACACCGGTC 3'
   ||| ||||||||||||||||
3' GAATGCGGTTGTGTGGCCAG 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr6L:58318588..58318607 19/20 Sense target ezh2.L
Chr8S:86574385..86574404 18/20 Antisense off-target lrfn1.1.S
Chr6L:16966946..16966965 17/20 Sense off-target LOC108718467
Chr2L:55619891..55619910 16/20 Antisense off-target trim33.L
tropicalis 10.0 Chr6:55142695..55142714 20/20 Sense target ezh2
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers