Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659110

gRNA Name: ccn4 gRNA1
Synonyms:
Genomic Target: ccn4

Sequence: 5' GATACGTGTGATACTCACAA 3'



Genomic Target tropicalis
Identities 20/20
genome
gRNA
5' TTGTGAGTATCACACGTATC 3'
   ||||||||||||||||||||
3' AACACTCATAGTGTGCATAG 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr8S:49937454..49937473 16/20 Antisense off-target snx12.S
tropicalis 10.0 Chr6:143660030..143660049 20/20 Sense target ccn4
Chr1:212183262..212183281 18/20 Sense off-target cntfr
Chr5:138765955..138765974 17/20 Antisense unknown
Chr5:139676739..139676758 17/20 Antisense unknown
Chr5:139970190..139970209 17/20 Sense unknown
Chr5:140195937..140195956 17/20 Antisense unknown
Chr5:140199611..140199630 17/20 Antisense unknown
Chr8:100453873..100453892 17/20 Sense unknown
Chr5:2326797..2326816 16/20 Antisense unknown
Publications
First: Maximizing CRISPR/Cas9 phenotype penetrance applying predictive modeling of editing outcomes in Xenopus and zebrafish embryos., Sci Rep 2020                        
Most recent:
View All Papers