Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659105

gRNA Name: cfap43 gRNA2
Synonyms: cfap43 sgRNA2
Genomic Target: cfap43

Sequence: 5' CCAGTGAGAGATCTCTTACTGTG 3'



Genomic Target laevis.L
Identities 23/23
genome
gRNA
5' CACAGTAAGAGATCTCTCACTGG 3'
   |||||||||||||||||||||||
3' GTGTCATTCTCTAGAGAGTGACC 5'
     
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:52895965..52895987 23/23 Sense target cfap43.L
Chr6S:36365667..36365689 20/23 Sense off-target LOC108719942
Chr8L:126286099..126286121 19/23 Antisense unknown
tropicalis 10.0 Chr10:26674193..26674215 19/23 Sense off-target aatk
Chr7:120317098..120317120 19/23 Sense off-target has1l
Publications
First: CFAP43 modulates ciliary beating in mouse and Xenopus., Dev Biol 2020                                                                      
Most recent:
View All Papers