Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-GRNA-23659104

gRNA Name: cfap43 gRNA1
Synonyms: cfap43 sgRNA1
Genomic Target: cfap43

Sequence: 5' CCTCACTGGGAAGTTTGACTGGC 3'



Genomic Target tropicalis laevis.L
Identities 23/23 23/23
genome
gRNA
5' GCCAGTCAAACTTCCCAGTGAGG 3'
   |||||||||||||||||||||||
3' CGGTCAGTTTGAAGGGTCACTCC 5'
5' GCCAGTCAAACTTCCCAGTGAGG 3'
   |||||||||||||||||||||||
3' CGGTCAGTTTGAAGGGTCACTCC 5'
    
Genomic Alignments Position Identity Strand Target Genomic Target
laevis 10.1 Chr3L:52896360..52896382 23/23 Antisense target cfap43.L
Chr4S:56720254..56720276 19/23 Antisense unknown
tropicalis 10.0 Chr3:45449699..45449721 23/23 Antisense target cfap43
Chr9:83591038..83591060 20/23 Sense off-target tuba1al
Chr1:137526568..137526590 19/23 Antisense off-target LOC116406621
Chr8:29399422..29399444 19/23 Sense unknown
Publications
First: CFAP43 modulates ciliary beating in mouse and Xenopus., Dev Biol 2020                                                                      
Most recent:
View All Papers