Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23622782

Morpholino Name: fermt2 MO2
Synonyms: kindlin2 MO2, xkindlin2 MO2
Target mRNA: fermt2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATACCATCCAAAGCCATGATTCCT T 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/26 24/26 23/26
genome
MO
5' AGGAACCATGGCTTTGGATGGTAT 3'
   ||||| ||||||||||||||||||
3' TCCTTAGTACCGAAACCTACCATA 5'
5' AGGAATCATGGCTTTGGATGGTAT 3'
   ||||||||||||||||||||||||
3' TCCTTAGTACCGAAACCTACCATA 5'
5' AGGAACCATGGCTTTGGATGGTAT 3'
   ||||| ||||||||||||||||||
3' TCCTTAGTACCGAAACCTACCATA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:85578666..85578689 24/24 Sense target fermt2.L
Chr8S:14146887..14146910 23/24 Antisense target fermt2.S
Chr1S:189244599..189244622 20/24 Sense off-target LOC121399539
Chr8L:113830441..113830464 21/24 Sense unknown
tropicalis 10.0 Chr8:94647729..94647752 23/24 Sense target fermt2
Chr1:43706426..43706449 20/24 Sense off-target mtnr1a
Chr2:80274701..80274724 20/24 Sense unknown
Publications
First: Kindlin2 regulates neural crest specification via integrin-independent regulation of the FGF signaling pathway., Development 2021                                            
Most recent:
View All Papers