Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23622781

Morpholino Name: fermt2 MO3
Synonyms: kindlin2, xkindlin2 MO1
Target mRNA: fermt2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCACGTCACTGCTTCTCAATCTGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ACCAGATTGAGAAGCAGTGACGTGA 3'
   |||||||||||||||||||||||||
3' TGGTCTAACTCTTCGTCACTGCACT 5'
5' ACCAGATTGAGAAGCAGTGACGTGA 3'
   |||||||||||||||||||||||||
3' TGGTCTAACTCTTCGTCACTGCACT 5'
5' ACCAGATTGAGAAGCAGTGACGTGA 3'
   |||||||||||||||||||||||||
3' TGGTCTAACTCTTCGTCACTGCACT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:85580128..85580152 25/25 Sense target fermt2.L
Chr8S:14144876..14144900 25/25 Antisense target fermt2.S
tropicalis 10.0 Chr8:94648998..94649022 25/25 Sense target fermt2
Publications
First: Kindlin2 regulates neural crest specification via integrin-independent regulation of the FGF signaling pathway., Development 2021                                            
Most recent:
View All Papers