Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23622630

Morpholino Name: uqcrc2 MO2
Synonyms: uqcrc2.S MO
Target mRNA: uqcrc2

Morpholino Type: splice blocking morpholino
Sequence: 5' CCCCTAACCCATTAAACATATACCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' AGGTATATGTTTAATGGGTTAGGGG 3'
   |||||||||||||||||||||||||
3' TCCATATACAAATTACCCAATCCCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10S:97270572..97270596 25/25 Sense target uqcrc2.S
Chr1L:87883383..87883407 22/25 Sense off-target fras1.L
Chr3S:123517277..123517301 21/25 Antisense off-target slc44a2.S
Chr3S:107084278..107084302 21/25 Sense unknown
tropicalis 10.0 Chr3:140140861..140140885 21/25 Sense off-target epor
Chr3:140141341..140141365 21/25 Sense off-target epor
Chr3:140141401..140141425 21/25 Sense off-target epor
Chr3:140141461..140141485 21/25 Sense off-target epor
Chr3:140141521..140141545 21/25 Sense off-target epor
Chr3:140141581..140141605 21/25 Sense off-target epor
Chr3:140141697..140141721 21/25 Sense off-target epor
Chr3:140141757..140141781 21/25 Sense off-target epor
Chr3:140140921..140140945 21/25 Sense off-target epor
Chr3:140140981..140141005 21/25 Sense off-target epor
Chr3:140141041..140141065 21/25 Sense off-target epor
Chr3:140141101..140141125 21/25 Sense off-target epor
Chr3:140141161..140141185 21/25 Sense off-target epor
Chr3:140141221..140141245 21/25 Sense off-target epor
Chr3:140141281..140141305 21/25 Sense off-target epor
Chr3:140141817..140141841 21/25 Sense off-target epor
Chr3:140141877..140141901 21/25 Sense off-target epor
Chr3:140141937..140141961 21/25 Sense off-target epor
Chr3:140142053..140142077 21/25 Sense off-target epor
Chr3:140142225..140142249 21/25 Sense off-target epor
Chr3:140142285..140142309 21/25 Sense off-target epor
Chr3:140142401..140142425 21/25 Sense off-target epor
Chr3:140142517..140142541 21/25 Sense off-target epor
Chr3:140142577..140142601 21/25 Sense off-target epor
Chr3:140142637..140142661 21/25 Sense off-target epor
Chr3:140142869..140142893 21/25 Sense off-target epor
Chr3:140137009..140137033 21/25 Sense off-target epor
Chr3:140137069..140137093 21/25 Sense off-target epor
Chr3:140137129..140137153 21/25 Sense off-target epor
Chr3:140137189..140137213 21/25 Sense off-target epor
Chr3:140137305..140137329 21/25 Sense off-target epor
Chr3:140137477..140137501 21/25 Sense off-target epor
Chr3:140137593..140137617 21/25 Sense off-target epor
Chr3:140137653..140137677 21/25 Sense off-target epor
Chr3:140137769..140137793 21/25 Sense off-target epor
Chr3:140138117..140138141 21/25 Sense off-target epor
Chr3:140138177..140138201 21/25 Sense off-target epor
Chr3:140138853..140138877 21/25 Sense off-target epor
Chr3:140138913..140138937 21/25 Sense off-target epor
Chr3:140138973..140138997 21/25 Sense off-target epor
Chr3:140139033..140139057 21/25 Sense off-target epor
Chr3:140139093..140139117 21/25 Sense off-target epor
Chr3:140139153..140139177 21/25 Sense off-target epor
Chr3:140139213..140139237 21/25 Sense off-target epor
Chr3:140139273..140139297 21/25 Sense off-target epor
Chr3:140139333..140139357 21/25 Sense off-target epor
Chr3:140139393..140139417 21/25 Sense off-target epor
Chr3:140139453..140139477 21/25 Sense off-target epor
Chr3:140139513..140139537 21/25 Sense off-target epor
Chr3:140139629..140139653 21/25 Sense off-target epor
Chr3:140139689..140139713 21/25 Sense off-target epor
Chr3:140139749..140139773 21/25 Sense off-target epor
Chr3:140139921..140139945 21/25 Sense off-target epor
Chr3:140140037..140140061 21/25 Sense off-target epor
Chr3:140140097..140140121 21/25 Sense off-target epor
Chr3:140140213..140140237 21/25 Sense off-target epor
Chr3:140140273..140140297 21/25 Sense off-target epor
Chr3:140140333..140140357 21/25 Sense off-target epor
Chr3:140140393..140140417 21/25 Sense off-target epor
Chr3:140140513..140140537 21/25 Sense off-target epor
Chr3:140140573..140140597 21/25 Sense off-target epor
Chr3:140140801..140140825 21/25 Sense off-target epor
Chr3:140140453..140140477 21/25 Sense off-target epor
Chr3:138261866..138261890 21/25 Antisense off-target slc44a2
Chr3:138261926..138261950 21/25 Antisense off-target slc44a2
Chr3:138261986..138262010 21/25 Antisense off-target slc44a2
Chr3:138262046..138262070 21/25 Antisense off-target slc44a2
Chr3:138262166..138262190 21/25 Antisense off-target slc44a2
Chr3:138262226..138262250 21/25 Antisense off-target slc44a2
Chr3:139344649..139344673 21/25 Sense off-target tlcd4.2
Chr3:139344709..139344733 21/25 Sense off-target tlcd4.2
Chr3:139344769..139344793 21/25 Sense off-target tlcd4.2
Chr3:139344885..139344909 21/25 Sense off-target tlcd4.2
Chr3:139344945..139344969 21/25 Sense off-target tlcd4.2
Chr3:139345121..139345145 21/25 Sense off-target tlcd4.2
Chr3:139345237..139345261 21/25 Sense off-target tlcd4.2
Chr3:139345297..139345321 21/25 Sense off-target tlcd4.2
Chr3:139345357..139345381 21/25 Sense off-target tlcd4.2
Chr3:139345473..139345497 21/25 Sense off-target tlcd4.2
Chr3:139345589..139345613 21/25 Sense off-target tlcd4.2
Chr3:139345705..139345729 21/25 Sense off-target tlcd4.2
Chr3:139345765..139345789 21/25 Sense off-target tlcd4.2
Chr3:139345825..139345849 21/25 Sense off-target tlcd4.2
Chr3:139345941..139345965 21/25 Sense off-target tlcd4.2
Chr3:139346001..139346025 21/25 Sense off-target tlcd4.2
Chr3:139346061..139346085 21/25 Sense off-target tlcd4.2
Chr3:139346177..139346201 21/25 Sense off-target tlcd4.2
Chr3:139346237..139346261 21/25 Sense off-target tlcd4.2
Chr3:139346297..139346321 21/25 Sense off-target tlcd4.2
Chr3:139346357..139346381 21/25 Sense off-target tlcd4.2
Chr3:139346417..139346441 21/25 Sense off-target tlcd4.2
Chr3:139346477..139346501 21/25 Sense off-target tlcd4.2
Chr3:139346537..139346561 21/25 Sense off-target tlcd4.2
Chr3:139346709..139346733 21/25 Sense off-target tlcd4.2
Chr3:139346769..139346793 21/25 Sense off-target tlcd4.2
Chr3:139346829..139346853 21/25 Sense off-target tlcd4.2
Chr3:139347001..139347025 21/25 Sense off-target tlcd4.2
Chr3:139347061..139347085 21/25 Sense off-target tlcd4.2
Chr3:139347177..139347201 21/25 Sense off-target tlcd4.2
Chr3:139347293..139347317 21/25 Sense off-target tlcd4.2
Chr3:139347409..139347433 21/25 Sense off-target tlcd4.2
Chr3:139347637..139347661 21/25 Sense off-target tlcd4.2
Chr3:139347697..139347721 21/25 Sense off-target tlcd4.2
Chr3:139347757..139347781 21/25 Sense off-target tlcd4.2
Chr3:139347929..139347953 21/25 Sense off-target tlcd4.2
Chr3:139347989..139348013 21/25 Sense off-target tlcd4.2
Chr3:139348495..139348519 21/25 Sense off-target tlcd4.2
Chr3:139348555..139348579 21/25 Sense off-target tlcd4.2
Chr3:139348615..139348639 21/25 Sense off-target tlcd4.2
Chr3:139348675..139348699 21/25 Sense off-target tlcd4.2
Chr3:139348735..139348759 21/25 Sense off-target tlcd4.2
Chr3:139348963..139348987 21/25 Sense off-target tlcd4.2
Chr3:139349023..139349047 21/25 Sense off-target tlcd4.2
Chr3:139349139..139349163 21/25 Sense off-target tlcd4.2
Chr3:139349255..139349279 21/25 Sense off-target tlcd4.2
Chr3:139349427..139349451 21/25 Sense off-target tlcd4.2
Chr3:139349487..139349511 21/25 Sense off-target tlcd4.2
Chr3:139349547..139349571 21/25 Sense off-target tlcd4.2
Chr3:139349719..139349743 21/25 Sense off-target tlcd4.2
Chr3:139349779..139349803 21/25 Sense off-target tlcd4.2
Chr5:159987314..159987338 21/25 Sense unknown
Chr6:121746007..121746031 21/25 Antisense unknown
Chr2:22759570..22759594 21/25 Antisense unknown
Publications
First: Functional assessment of the "two-hit" model for neurodevelopmental defects in Drosophila and X. laevis., PLoS Genet 2021                      
Most recent: 16p12.1 Deletion Orthologs are Expressed in Motile Neural Crest Cells and are Important for Regulating Craniofacial Development in Xenopus laevis., Front Genet 2022                          
View All Papers