Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-23622559

Morpholino Name: ddx3x MO2
Synonyms: DDX3-2 MO
Target mRNA: ddx3x

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTCCACGGCCACATGACTCATAAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' GTTATGAGTCATGTGGCCGTGGAAA 3'
   |||||||||||||||||||||||||
3' CAATACTCAGTACACCGGCACCTTT 5'
5' GTTATGAGTCATGTGGCCGTGGAAA 3'
   |||||||||||||||||||||||||
3' CAATACTCAGTACACCGGCACCTTT 5'
5' GTTATGAGTCATGTGGCCGTGGAAA 3'
   |||||||||||||||||||||||||
3' CAATACTCAGTACACCGGCACCTTT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:82274689..82274713 25/25 Antisense target ddx3x.L
Chr2S:48908954..48908978 25/25 Sense target ddx3x.S
tropicalis 10.0 Chr2:56700284..56700308 25/25 Sense target ddx3x
Publications
First: The RNA helicase DDX3 induces neural crest by promoting AKT activity., Development 2021                            
Most recent:
View All Papers