Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22249211

Morpholino Name: dab2 MO4
Synonyms: XDab2-MO2
Target mRNA: dab2

Morpholino Type: splice blocking morpholino
Sequence: 5' CCTCCAGTCATGTCTACTGATGTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' CTACATCAGTAGACATGACTGGAGG 3'
   |||||||||||||||||||||||||
3' GATGTAGTCATCTGTACTGACCTCC 5'
5' CTACATCAGTAGACATGACTGGAGG 3'
   |||||||||||||||||||||||||
3' GATGTAGTCATCTGTACTGACCTCC 5'
5' CTACATCAGTAGACATGACTGGAGG 3'
   |||||||||||||||||||||||||
3' GATGTAGTCATCTGTACTGACCTCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:214063092..214063116 25/25 Sense target dab2.L
Chr1S:185293970..185293994 25/25 Sense target dab2.S
Chr6S:70220521..70220545 21/25 Antisense off-target cdh6.S
Chr3S:68606854..68606878 21/25 Sense off-target celf2.S
Chr2S:1919168..1919192 21/25 Antisense unknown
tropicalis 10.0 Chr1:196558925..196558949 25/25 Sense target dab2
Chr7:34499034..34499058 21/25 Antisense unknown
Publications
First: Disabled-2: a positive regulator of the early differentiation of myoblasts., Cell Tissue Res 2020                                
Most recent:
View All Papers