Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22249210

Morpholino Name: dab2 MO3
Synonyms: XDab2-MO1
Target mRNA: dab2

Morpholino Type: splice blocking morpholino
Sequence: 5' ATCTGACTCTTATTTAATGATTGTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25 21/25
genome
MO
5' CACGATCATTAAATAAGAGTCAAGC 3'
   ||| ||||||||||||||||||   
3' GTGTTAGTAATTTATTCTCAGTCTA 5'
5' CACAATCATTAAATAAGAGTCAGAT 3'
   |||||||||||||||||||||||||
3' GTGTTAGTAATTTATTCTCAGTCTA 5'
5' CACGATCATTAAATAAGAGTCAAGC 3'
   ||| ||||||||||||||||||   
3' GTGTTAGTAATTTATTCTCAGTCTA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:214063052..214063076 25/25 Sense target dab2.L
Chr1S:185293930..185293954 21/25 Sense target dab2.S
Chr7L:95949210..95949234 22/25 Sense off-target LOC108696553
Chr9_10S:78811256..78811280 21/25 Antisense off-target fzd7.S
Chr2L:80464680..80464704 21/25 Sense off-target sytl5.L
tropicalis 10.0 Chr1:196558885..196558909 21/25 Sense target dab2
Chr3:73971806..73971830 22/25 Sense unknown
Publications
First: Disabled-2: a positive regulator of the early differentiation of myoblasts., Cell Tissue Res 2020                                
Most recent:
View All Papers