Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22249065

Morpholino Name: fbrsl1 MO1
Synonyms: fbrsl1 E1/I1
Target mRNA: fbrsl1

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' ATAACTCTCTCTTACCTCTAAGGCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 24/25
genome
MO
5' AGCCTTAGAGGTAAGAAAGAGTTAT 3'
   |||||||||||||||| ||||||||
3' TCGGAATCTCCATTCTCTCTCAATA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:169236978..169237002 25/25 Sense off-target LOC108716118
Chr1S:144612882..144612906 24/25 Sense off-target LOC108707141
Chr8L:51239730..51239754 21/25 Antisense off-target kiaa1210.L
Chr1S:119764056..119764080 21/25 Sense off-target LOC121399438
Chr1S:116486625..116486649 21/25 Antisense unknown
Chr1S:116606854..116606878 21/25 Antisense unknown
Chr1S:116650759..116650783 21/25 Antisense unknown
Chr1S:116730629..116730653 21/25 Antisense unknown
Chr1S:116832198..116832222 21/25 Antisense unknown
Chr1S:116879346..116879370 21/25 Antisense unknown
Chr1S:117249168..117249192 21/25 Sense unknown
Chr1S:117286066..117286090 21/25 Sense unknown
Chr1S:118491952..118491976 21/25 Antisense unknown
Chr6L:53567307..53567331 21/25 Antisense unknown
tropicalis 10.0 Chr1:155866727..155866751 24/25 Sense target fbrsl1
Chr2:122318038..122318062 21/25 Antisense off-target dnajc3
Chr8:85975326..85975350 21/25 Antisense off-target zc3h14
Chr3:112292850..112292874 21/25 Sense off-target st8sia2
Chr5:49987935..49987959 21/25 Antisense unknown
Publications
First: De novo mutations in FBRSL1 cause a novel recognizable malformation and intellectual disability syndrome., Hum Genet 2020                                          
Most recent:
View All Papers