Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22194338

Morpholino Name: fbxo45 MO1
Synonyms:
Target mRNA: fbxo45

Morpholino Type: splice blocking morpholino (E1-I1)
Sequence: 5' TATCTGTGGTGGGAAGAAAAGGTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 23/25
genome
MO
5' TGACCTTTTCTTCTTTCCACAGATA 3'
   |||||||||||||   |||||||||
3' ACTGGAAAAGAAGGGTGGTGTCTAT 5'
5' TGACCTTTTCTTCCCACCACAGATA 3'
   |||||||||||||||||||||||||
3' ACTGGAAAAGAAGGGTGGTGTCTAT 5'
5' TTAACTTTTCTTCCCACCACAGATA 3'
   | | |||||||||||||||||||||
3' ACTGGAAAAGAAGGGTGGTGTCTAT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:139810153..139810177 25/25 Sense target fbxo45.L
Chr5S:117282656..117282680 23/25 Sense target fbxo45.S
Chr3S:92138119..92138143 21/25 Antisense off-target epyc.S
Chr2L:135852142..135852166 21/25 Antisense off-target tdrd3.L
Chr8L:4089268..4089292 21/25 Antisense off-target gpsm1.L
Chr5L:142978530..142978554 21/25 Antisense off-target ppp2r3a.L
Chr5L:142983296..142983320 21/25 Sense off-target ppp2r3a.L
Chr4S:4727097..4727121 21/25 Antisense off-target LOC108714924
Chr4S:4728111..4728135 21/25 Sense off-target LOC108714924
Chr5L:124109638..124109662 21/25 Sense off-target LOC121393808
Chr1L:160590291..160590315 21/25 Sense unknown
Chr4L:37535882..37535906 21/25 Sense unknown
Chr9_10L:20848752..20848776 21/25 Sense unknown
Chr9_10S:20157903..20157927 21/25 Sense unknown
tropicalis 10.0 Chr5:129850201..129850225 22/25 Sense target fbxo45
Chr3:146717100..146717124 22/25 Antisense off-target LOC100493016
Chr1:114426104..114426128 21/25 Antisense unknown
Publications
First: NCBP2 modulates neurodevelopmental defects of the 3q29 deletion in Drosophila and Xenopus laevis models., PLoS Genet 2020                          
Most recent:
View All Papers