Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063820

Morpholino Name: dkk1 MO1
Synonyms:
Target mRNA: dkk1

Morpholino Type: uncategorized morpholino
Sequence: 5' CATGTTGCTGCCCATTCCTCTGTCC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' GGACAGAGGAATGGGCAGCAACATG 3'
   |||||||||||||||||||||||||
3' CCTGTCTCCTTACCCGTCGTTGTAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:6356485..6356509 25/25 Antisense target dkk1.S
Chr3S:61786939..61786963 22/25 Sense off-target alpk3.S
Chr4S:120454877..120454901 22/25 Antisense off-target foxp1.S
Chr1S:138401347..138401371 21/25 Sense unknown
Chr2S:165847136..165847160 21/25 Sense unknown
Chr9_10S:27022405..27022429 21/25 Sense unknown
tropicalis 10.0 Chr6:60514643..60514667 21/25 Sense unknown
Publications
First: The Wnt inhibitor Dkk1 is required for maintaining the normal cardiac differentiation program in Xenopus laevis., Dev Biol 2019                                    
Most recent:
View All Papers