Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063814

Morpholino Name: fbxl17 MO5
Synonyms:
Target mRNA: fbxl17

Morpholino Type: splice blocking morpholino
Sequence: 5' ACAGTCTGCACATACCTATCATTGA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TCAATGATAGGTATGTGCAGACTGT 3'
   |||||||||||||||||||||||||
3' AGTTACTATCCATACACGTCTGACA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:189308114..189308138 25/25 Antisense target fbxl17.L
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers