Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063813

Morpholino Name: fbxl17 MO4
Synonyms:
Target mRNA: fbxl17

Morpholino Type: splice blocking morpholino (E2-I2)
Sequence: 5' CTTGTTTTACTACACAGTACCTGCT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' AGCAGGTACTGTGTAGTAAAACAAG 3'
   |||||||||||||||||||||||||
3' TCGTCCATGACACATCATTTTGTTC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:189229445..189229469 25/25 Antisense target fbxl17.L
Chr7S:70054552..70054576 21/25 Sense off-target hmbs.2.S
Chr3L:3493152..3493176 22/25 Antisense unknown
Chr7S:57447603..57447627 22/25 Antisense unknown
Chr3S:88513549..88513573 21/25 Antisense unknown
tropicalis 10.0 Chr1:110832332..110832356 21/25 Sense off-target dgkq
Chr7:115903440..115903464 21/25 Sense off-target ccdc63
Chr5:29213960..29213984 21/25 Antisense off-target macrod2
Chr5:64574602..64574626 21/25 Antisense off-target phactr2
Chr8:63538202..63538226 21/25 Sense unknown
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers