Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063812

Morpholino Name: fbxl17 MO3
Synonyms:
Target mRNA: fbxl17

Morpholino Type: splice blocking morpholino
Sequence: 5' AGTTCATACAGATACTTACTTTGGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACCAAAGTAAGTATCTGTATGAACT 3'
   |||||||||||||||||||||||||
3' TGGTTTCATTCATAGACATACTTGA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:189302284..189302308 25/25 Antisense target fbxl17.L
Chr1S:42604135..42604159 22/25 Antisense off-target glrb.S
Chr4L:70288474..70288498 22/25 Sense off-target ndrg4.L
Chr4L:31027169..31027193 21/25 Sense off-target pc.1.L
Chr5L:31375578..31375602 21/25 Sense off-target vps54.L
Chr9_10L:43254837..43254861 21/25 Sense unknown
Chr1S:162327722..162327746 21/25 Antisense unknown
tropicalis 10.0 Chr4:77762438..77762462 21/25 Antisense off-target prkacb
Chr10:41431784..41431808 21/25 Sense unknown
Chr8:96344543..96344567 21/25 Antisense unknown
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers