Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063810

Morpholino Name: fbxl17 MO1
Synonyms:
Target mRNA: fbxl17

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TTCTTGCGCTTGCACACCATGTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 23/23
genome
MO
5' GACATGGTGTGCAAGCGCAAGAA 3'
   |||||||||||||||||||||||
3' CTGTACCACACGTTCGCGTTCTT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:47751731..47751753 19/23 Antisense off-target tnfaip3.S
Chr2S:2367251..2367273 19/23 Antisense off-target LOC108709162
Chr1L:189223836..189223858 23/23 Antisense unknown
Chr1S:103398778..103398800 19/23 Antisense unknown
tropicalis 10.0 Chr1:174200168..174200190 23/23 Antisense target fbxl17
Chr9:74676550..74676572 21/23 Antisense unknown
Publications
First: Dimerization quality control ensures neuronal development and survival., Science 2018  
Most recent:
View All Papers