Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22063109

Morpholino Name: rara MO8
Synonyms: RARalpha-MO
Target mRNA: rara

Morpholino Type: uncategorized morpholino
Sequence: 5' CGTCCACATTCTCATACATCCTAAA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 21/25
genome
MO
5' TGTAGGATGTACGAGAATGTGGACG 3'
   | ||||||||| |||||||||||||
3' AAATCCTACATACTCTTACACCTGC 5'
5' TTTAGGATGTATGAGAATGTGGACG 3'
   |||||||||||||||||||||||||
3' AAATCCTACATACTCTTACACCTGC 5'
5' AGTAGAATGTACGAGAATGTGGACG 3'
     ||| ||||| |||||||||||||
3' AAATCCTACATACTCTTACACCTGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:1666198..1666222 25/25 Sense target rara.L
Chr9_10S:1464415..1464439 21/25 Sense target rara.S
Chr2S:164059620..164059644 22/25 Sense unknown
Chr1S:77971334..77971358 21/25 Sense unknown
tropicalis 10.0 Chr10:8760350..8760374 23/25 Sense target rara
Publications
First: Alteration of the Retinoid Acid-CBP Signaling Pathway in Neural Crest Induction Contributes to Enteric Nervous System Disorder., Front Pediatr 2018                          
Most recent:
View All Papers