Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22061326

Morpholino Name: rpsa MO1
Synonyms:
Target mRNA: rpsa

Morpholino Type: translation blocking morpholino (5' UTR)
Sequence: 5' CCGGACATTGTGAGTTACCCCTTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/24 24/24 24/24
genome
MO
5' AAAGGGGTAACTCACAATGTCCGG 3'
   ||||||||||||||||||||||||
3' TTTCCCCATTGAGTGTTACAGGCC 5'
5' AAAGGGGTAACTCACAATGTCCGG 3'
   ||||||||||||||||||||||||
3' TTTCCCCATTGAGTGTTACAGGCC 5'
5' AAAGGGGTAACTCACAATGTCCGG 3'
   ||||||||||||||||||||||||
3' TTTCCCCATTGAGTGTTACAGGCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:112491923..112491946 24/24 Sense target rpsa.L
Chr4S:94261973..94261996 24/24 Sense target rpsa.S
Chr1L:175234607..175234630 20/24 Antisense off-target abcb9.L
Chr3L:19247861..19247884 20/24 Antisense unknown
tropicalis 10.0 Chr4:115363894..115363917 24/24 Sense target rpsa
Chr3:92565804..92565827 20/24 Sense off-target insyn1
Publications
First: RPSA, a candidate gene for isolated congenital asplenia, is required for pre-rRNA processing and spleen formation in Xenopus., Development 2018                    
Most recent:
View All Papers