Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22061197

Morpholino Name: fam183b MO2
Synonyms: SBMO
Target mRNA: fam183b

Morpholino Type: splice blocking morpholino
Sequence: 5' TGCCCTCATTCATTACCCTTCCGAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ATCGGAAGGGTAATGAATGAGGGCA 3'
   |||||||||||||||||||||||||
3' TAGCCTTCCCATTACTTACTCCCGT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:83065543..83065567 25/25 Antisense target fam183b.L
Chr5S:107459398..107459422 21/25 Sense unknown
Publications
First: The evolutionary conserved FOXJ1 target gene Fam183b is essential for motile cilia in Xenopus but dispensable for ciliary function in mice., Sci Rep 2018              
Most recent:
View All Papers