Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22060857

Morpholino Name: wdr5 MO5
Synonyms:
Target mRNA: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGCAAGAACAACTTGTGGCCGGATA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr4:15845942..15845966 21/25 Antisense unknown
Publications
First: WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation., Dev Cell 2018                                
Most recent: WDR5 regulates left-right patterning via chromatin-dependent and -independent functions., Development 2018                  
View All Papers