Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22060856

Morpholino Name: wdr5 MO4
Synonyms:
Target mRNA: wdr5

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGGGTTTCTTTTCTTCTGTTGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 23/25 25/25
genome
MO
5' ATGGCAACAGAAGAAAAGAAACCCG 3'
   |||||||||||||||||||||||||
3' TACCGTTGTCTTCTTTTCTTTGGGC 5'
5' ATGGCAACGGAAGAAAAGAAACCGG 3'
   |||||||| |||||||||||||| |
3' TACCGTTGTCTTCTTTTCTTTGGGC 5'
5' ATGGCAACAGAAGAAAAGAAACCCG 3'
   |||||||||||||||||||||||||
3' TACCGTTGTCTTCTTTTCTTTGGGC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8S:30353458..30353482 25/25 Sense target wdr5.S
Chr8L:5594843..5594867 23/25 Sense target wdr5.L
Chr2S:95394140..95394164 21/25 Antisense off-target msi2.S
Chr4S:29587037..29587061 21/25 Antisense off-target nkd1.S
Chr4L:88319472..88319496 21/25 Antisense off-target uqcrh.L
Chr7L:124949431..124949455 21/25 Sense off-target cadm4.L
Chr8S:30665887..30665911 21/25 Sense off-target garnl3.S
Chr5L:112484330..112484354 21/25 Sense off-target LOC108716979
Chr2L:175615545..175615569 21/25 Sense unknown
Chr3S:65404704..65404728 21/25 Antisense unknown
Chr4S:29460343..29460367 21/25 Antisense unknown
Chr5S:73265817..73265841 21/25 Antisense unknown
Chr6L:161190370..161190394 21/25 Antisense unknown
Chr7L:127418064..127418088 21/25 Sense unknown
Chr7L:91019409..91019433 21/25 Sense unknown
tropicalis 10.0 Chr8:8202297..8202321 25/25 Sense target wdr5
Publications
First: WDR5 Stabilizes Actin Architecture to Promote Multiciliated Cell Formation., Dev Cell 2018                                
Most recent: WDR5 regulates left-right patterning via chromatin-dependent and -independent functions., Development 2018                  
View All Papers