Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22041778

Morpholino Name: rarg MO3
Synonyms: Rar gamma1.S
Target mRNA: rarg

Morpholino Type: uncategorized morpholino
Sequence: 5' CTAGCCAGTAGTTGTCTTGGAATCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' AGATTCCAAGACAACTACTGGCTAG 3'
   |||||||||||||||||||||||||
3' TCTAAGGTTCTGTTGATGACCGATC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:138904625..138904649 25/25 Antisense target rarg.S
Chr4L:61752313..61752337 22/25 Sense unknown
Chr3L:56031771..56031795 21/25 Sense unknown
Chr3S:98426658..98426682 21/25 Antisense unknown
Publications
First: RARγ is required for mesodermal gene expression prior to gastrulation in Xenopus., Development 2018                            
Most recent:
View All Papers