Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22041474

Morpholino Name: ddx21 MO1
Synonyms: ddx21a MO
Target mRNA: ddx21

Morpholino Type: translation blocking morpholino
Sequence: 5' CTGCATCAGAAAATCATTACCTTGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' ACAAGGTAATGATTTTCTGAGGCTG 3'
   |||||||||||||||||||| || |
3' TGTTCCATTACTAAAAGACTACGTC 5'
5' ACAAGGTAATGATTTTCTGATGCAG 3'
   |||||||||||||||||||||||||
3' TGTTCCATTACTAAAAGACTACGTC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:22735815..22735839 25/25 Antisense target ddx21.S
Chr7L:36228948..36228972 23/25 Sense target ddx21.L
Chr3L:68973897..68973921 23/25 Sense off-target LOC108711107
Chr1L:142588786..142588810 21/25 Sense off-target pcsk5.L
Chr4S:70881186..70881210 21/25 Antisense off-target tesk2.S
Chr9_10L:35661158..35661182 21/25 Sense off-target slc12a5.L
Chr1L:168904460..168904484 21/25 Sense off-target LOC108716097
tropicalis 10.0 Chr2:168050862..168050886 22/25 Sense off-target ctsc
Publications
First: Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders., Nature 2018  
Most recent:
View All Papers