Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-22041328

Morpholino Name: ras-dva2 MO1
Synonyms:
Target mRNA: ras-dva2

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTTCTCCTTTGTGGACAGTGACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGTCACTGTCCACAAAGGAGAAGA 3'
   |||||||||||||||||||||||||
3' TACAGTGACAGGTGTTTCCTCTTCT 5'
5' ATGTCACTGTCCACAAAGGAGAAGA 3'
   |||||||||||||||||||||||||
3' TACAGTGACAGGTGTTTCCTCTTCT 5'
5' ATGTCACTGTCCACAAAGGAGAAGA 3'
   |||||||||||||||||||||||||
3' TACAGTGACAGGTGTTTCCTCTTCT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:48549536..48549560 25/25 Antisense target ras-dva2.L
Chr9_10S:41268629..41268653 25/25 Antisense target ras-dva2.S
Chr6S:18279183..18279207 21/25 Sense off-target mkx.S
tropicalis 10.0 Chr10:45685213..45685237 25/25 Antisense target ras-dva2
Publications
First: Ras-dva small GTPases lost during evolution of amniotes regulate regeneration in anamniotes., Sci Rep 2018                                                      
Most recent:
View All Papers