Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-19778019

Morpholino Name: hdac1 MO3
Synonyms:
Target mRNA: hdac1

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGACCTACTACTACTTTGACCGGC 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' GCCGGTCAAAGTAGTAGTAGGTCTT 3'
   |||||||||||||||||||||||||
3' CGGCCAGTTTCATCATCATCCAGAA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:89730017..89730041 25/25 Sense target hdac1.L
Chr4L:41690485..41690509 21/25 Antisense off-target rbl2.L
Publications
First: A novel role for Ascl1 in the regulation of mesendoderm formation via HDAC-dependent antagonism of VegT., Development 2016                              
Most recent:
View All Papers