Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-19756314

Morpholino Name: dact1 MO3
Synonyms: Dapper1 MO
Target mRNA: dact1

Morpholino Type: uncategorized morpholino
Sequence: 5' GATCGGCTTCATCCTCTGGGAACGA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TCGTTCCCAGAGGATGAAGCCGATC 3'
   |||||||||||||||||||||||||
3' AGCAAGGGTCTCCTACTTCGGCTAG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:94779210..94779234 25/25 Sense target dact1.L
Chr1L:188824426..188824450 22/25 Antisense off-target man2a1.L
Publications
First: Head formation requires Dishevelled degradation that is mediated by March2 in concert with Dapper1., Development 2018                
Most recent:
View All Papers