Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-18386372

Morpholino Name: rapgef5 MO2
Synonyms:
Target mRNA: rapgef5

Morpholino Type: splice blocking morpholino
Sequence: 5' GCCTAAGGAAAAACTCTTACCTCCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 25/25
genome
MO
5' TGGAGGTAAGAGTTTTTCCTTAGGC 3'
   |||||||||||||||||||||||||
3' ACCTCCATTCTCAAAAAGGAATCCG 5'
5' TGGAGGTAAGAGTTTTTCCTTAGGC 3'
   |||||||||||||||||||||||||
3' ACCTCCATTCTCAAAAAGGAATCCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:40636871..40636895 25/25 Sense target rapgef5.L
Chr3S:44903576..44903600 21/25 Antisense off-target ticrr.S
Chr4S:76181034..76181058 21/25 Antisense off-target rnf11.S
Chr1L:72748102..72748126 21/25 Sense off-target LOC121403011
Chr3S:44903576..44903600 21/25 Antisense off-target LOC121402150
Chr4S:107620879..107620903 21/25 Antisense off-target LOC108715035
Chr4S:107620879..107620903 21/25 Antisense off-target LOC121393360
Chr4S:76181034..76181058 21/25 Antisense off-target LOC121393312
Chr6S:32280605..32280629 25/25 Sense unknown
Chr1L:32689005..32689029 21/25 Sense unknown
Chr2L:26114182..26114206 21/25 Antisense unknown
Chr3L:126417518..126417542 21/25 Antisense unknown
Chr5S:46797629..46797653 21/25 Sense unknown
Chr5S:46800369..46800393 21/25 Antisense unknown
tropicalis 10.0 Chr6:39757381..39757405 25/25 Sense target rapgef5
Publications
First: RAPGEF5 Regulates Nuclear Translocation of β-Catenin., Dev Cell 2018                                                  
Most recent:
View All Papers